pgex 6p 1 Search Results


arginines 8r  (Cytiva Europe)
95
Cytiva Europe arginines 8r
Loss <t>of</t> <t>Cited2</t> Impairs Expression of Genes Specifying Cardiac Mesoderm (A) Percentage of colonies with beating foci derived from C2 fl/fl and C2 Δ/Δ [LA11] ESC at D8 and D10 of differentiation. (B) Percentage of colonies with beating foci counted at 8 and 10 days after the initiation of differentiation in cell cultures derived from C2 fl/fl [Cre] ESC treated with ethanol or 4HT at D0 of differentiation, and with 4HT at D0 of differentiation and supplemented with recombinant <t>8R-CITED2</t> protein at D2 of differentiation (4HT + 8R-CITED2). (C) Expression of Activin A and Nodal determined by qPCR at D2 and D3 of differentiation in cultures derived from C2 fl/fl [Cre] ESC treated with 4HT or ethanol at D0 for 48 hr. (D) Expression of mesoderm markers ( Brachyury and Mesp1 ) at D2, D3, D5, and D12 of differentiation in cells generated from C2 fl/fl [Cre] ESC treated as described in ( B). (E) Expression of Isl1 , Gata4 , Nkx2.5 , and Tbx5 in cell cultures as described in (D). The inserts for Isl1 and Tbx5 detail the expression of these genes at D5 and D3, respectively. (F) Relative expression of Brachyury , Mesp1 , Isl1 , Gata4 , Nkx2.5 , and Tbx5 determined by qPCR at D5 of differentiation in cultures derived from untreated C2 fl/fl and C2 Δ/Δ [LA11] ESC, and C2 Δ/Δ [LA11] ESC supplemented with the recombinant 8R-CITED2 protein (C2 Δ/Δ [LA11] + 8R-CITED2) at D2 of differentiation for 48 hr. Gene expression in C2 fl/fl ESC was set to 1. (G) Enrichment of Isl1 genomic regions in extracts of E14/T ESC-derived cells at D5 by ChIP assays with anti-CITED2 or control (immunoglobulin G) polyclonal antibodies. Results are presented as the mean ± SEM of three independent biological experiments.
Arginines 8r, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+6p+1/PGEX-6P-1+Vector/pmc05161512-165-9-17
Average 95 stars, based on 1 article reviews
arginines 8r - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier
pgex 6p 1 p37deltan  (Addgene inc)
90
Addgene inc pgex 6p 1 p37deltan
Loss <t>of</t> <t>Cited2</t> Impairs Expression of Genes Specifying Cardiac Mesoderm (A) Percentage of colonies with beating foci derived from C2 fl/fl and C2 Δ/Δ [LA11] ESC at D8 and D10 of differentiation. (B) Percentage of colonies with beating foci counted at 8 and 10 days after the initiation of differentiation in cell cultures derived from C2 fl/fl [Cre] ESC treated with ethanol or 4HT at D0 of differentiation, and with 4HT at D0 of differentiation and supplemented with recombinant <t>8R-CITED2</t> protein at D2 of differentiation (4HT + 8R-CITED2). (C) Expression of Activin A and Nodal determined by qPCR at D2 and D3 of differentiation in cultures derived from C2 fl/fl [Cre] ESC treated with 4HT or ethanol at D0 for 48 hr. (D) Expression of mesoderm markers ( Brachyury and Mesp1 ) at D2, D3, D5, and D12 of differentiation in cells generated from C2 fl/fl [Cre] ESC treated as described in ( B). (E) Expression of Isl1 , Gata4 , Nkx2.5 , and Tbx5 in cell cultures as described in (D). The inserts for Isl1 and Tbx5 detail the expression of these genes at D5 and D3, respectively. (F) Relative expression of Brachyury , Mesp1 , Isl1 , Gata4 , Nkx2.5 , and Tbx5 determined by qPCR at D5 of differentiation in cultures derived from untreated C2 fl/fl and C2 Δ/Δ [LA11] ESC, and C2 Δ/Δ [LA11] ESC supplemented with the recombinant 8R-CITED2 protein (C2 Δ/Δ [LA11] + 8R-CITED2) at D2 of differentiation for 48 hr. Gene expression in C2 fl/fl ESC was set to 1. (G) Enrichment of Isl1 genomic regions in extracts of E14/T ESC-derived cells at D5 by ChIP assays with anti-CITED2 or control (immunoglobulin G) polyclonal antibodies. Results are presented as the mean ± SEM of three independent biological experiments.
Pgex 6p 1 P37deltan, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+6p+1/pGEX-6P-1+p37deltaSEP+(Plasmid+%23113501)/pm30344098-267-108-112
Average 90 stars, based on 1 article reviews
pgex 6p 1 p37deltan - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
human p300  (Addgene inc)
93
Addgene inc human p300
FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
Human P300, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+6p+1/pGEX-6P-1-INTS3-N+(Plasmid+%23128416)/pm40452297-31-17-13
Average 93 stars, based on 1 article reviews
human p300 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
pgex 6p 1 p37 deltaubx  (Addgene inc)
90
Addgene inc pgex 6p 1 p37 deltaubx
Figure 3. The SEP Domain Adapters <t>p37,</t> p47, and UBXN2A Assist p97 in SDS22-PP1-I3 Disassembly (A) Domain structure of human p97 adapters that share a SEP domain of unknown function. The UBX domain and the SHP box mediate interaction with p97. Only p47 contains a ubiquitin-binding UBA domain. (B) Strep-Tactin pull-downs of indicated strep-hemagglutinin (HA)-tagged (SH) SEP domain adapters and western blot with indicated antibodies. Asterisk indicates an unspecific band detected by the SDS22 antibody. (C) p37, p47, and UBXN2A function partially redundantly as p97 adapters for SDS22-PP1-I3. p47 knockout (KO) or parental cells were treated with indicated siRNAs. p97 was immunoprecipitated and indicated associated proteins detected by western blot. Npl4 was probed as alternative p97 adapter control. (D) Partially redundant roles in PP1 complex disassembly. Autoradiography of pulse-chase experiments in p47 KO or parental HeLa cells combined with siRNA- mediated knockdown of p37 and UBXN2A or control depletion as indicated. (E) Quantification of (D). Shown are means ± SD; n = 3. (F) Loss of SEP domain adapters causes a shift in the PP1 interaction landscape. PP1 was isolated from p47 KO cells after depletion of p37 and UBXN2A or from control-depleted parental cells. Associated proteins were analyzed by quantitative mass spectrometry and results compared in a volcano plot. The black line indicates the threshold for significant differences between treatment conditions (false discovery rate [FDR] < 0.05; s0 = 0.1). Established direct PP1-interacting proteins (Heroes et al., 2013) are marked in black circles, of which those discussed in the text are labeled (closed circles). (G) Indicated proteins from (F) were validated by western blot. (H) Requirement of SEP domain adapters for cell viability and proliferation. Cell populations were treated as indicated and subjected to the 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay at indicated time points. Shown are means ± SD of one represen- tative experiment with technical triplicates. (I) Loss of adapters induces apoptosis. Lysates of indicated cell populations were subjected to western blot analysis to monitor poly ADP-ribose poly- merase 1 (PARP-1) and caspase-3 cleavage. See also Figure S3 and Table S1.
Pgex 6p 1 P37 Deltaubx, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+6p+1/pGEX-6P-1+p37+SHPmut+(Plasmid+%23113503)/pm30344098-267-121-126
Average 90 stars, based on 1 article reviews
pgex 6p 1 p37 deltaubx - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
pgex 6p 1 brd4 full length  (Addgene inc)
92
Addgene inc pgex 6p 1 brd4 full length
Figure 3. The SEP Domain Adapters <t>p37,</t> p47, and UBXN2A Assist p97 in SDS22-PP1-I3 Disassembly (A) Domain structure of human p97 adapters that share a SEP domain of unknown function. The UBX domain and the SHP box mediate interaction with p97. Only p47 contains a ubiquitin-binding UBA domain. (B) Strep-Tactin pull-downs of indicated strep-hemagglutinin (HA)-tagged (SH) SEP domain adapters and western blot with indicated antibodies. Asterisk indicates an unspecific band detected by the SDS22 antibody. (C) p37, p47, and UBXN2A function partially redundantly as p97 adapters for SDS22-PP1-I3. p47 knockout (KO) or parental cells were treated with indicated siRNAs. p97 was immunoprecipitated and indicated associated proteins detected by western blot. Npl4 was probed as alternative p97 adapter control. (D) Partially redundant roles in PP1 complex disassembly. Autoradiography of pulse-chase experiments in p47 KO or parental HeLa cells combined with siRNA- mediated knockdown of p37 and UBXN2A or control depletion as indicated. (E) Quantification of (D). Shown are means ± SD; n = 3. (F) Loss of SEP domain adapters causes a shift in the PP1 interaction landscape. PP1 was isolated from p47 KO cells after depletion of p37 and UBXN2A or from control-depleted parental cells. Associated proteins were analyzed by quantitative mass spectrometry and results compared in a volcano plot. The black line indicates the threshold for significant differences between treatment conditions (false discovery rate [FDR] < 0.05; s0 = 0.1). Established direct PP1-interacting proteins (Heroes et al., 2013) are marked in black circles, of which those discussed in the text are labeled (closed circles). (G) Indicated proteins from (F) were validated by western blot. (H) Requirement of SEP domain adapters for cell viability and proliferation. Cell populations were treated as indicated and subjected to the 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay at indicated time points. Shown are means ± SD of one represen- tative experiment with technical triplicates. (I) Loss of adapters induces apoptosis. Lysates of indicated cell populations were subjected to western blot analysis to monitor poly ADP-ribose poly- merase 1 (PARP-1) and caspase-3 cleavage. See also Figure S3 and Table S1.
Pgex 6p 1 Brd4 Full Length, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+6p+1/p5068+pGEX-6P-1+Brd4+full-length+(Plasmid+%2314447)/pmc08617031-344-7-15
Average 92 stars, based on 1 article reviews
pgex 6p 1 brd4 full length - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
vector pgex 6p1  (Cytiva Europe)
96
Cytiva Europe vector pgex 6p1
Figure 3. The SEP Domain Adapters <t>p37,</t> p47, and UBXN2A Assist p97 in SDS22-PP1-I3 Disassembly (A) Domain structure of human p97 adapters that share a SEP domain of unknown function. The UBX domain and the SHP box mediate interaction with p97. Only p47 contains a ubiquitin-binding UBA domain. (B) Strep-Tactin pull-downs of indicated strep-hemagglutinin (HA)-tagged (SH) SEP domain adapters and western blot with indicated antibodies. Asterisk indicates an unspecific band detected by the SDS22 antibody. (C) p37, p47, and UBXN2A function partially redundantly as p97 adapters for SDS22-PP1-I3. p47 knockout (KO) or parental cells were treated with indicated siRNAs. p97 was immunoprecipitated and indicated associated proteins detected by western blot. Npl4 was probed as alternative p97 adapter control. (D) Partially redundant roles in PP1 complex disassembly. Autoradiography of pulse-chase experiments in p47 KO or parental HeLa cells combined with siRNA- mediated knockdown of p37 and UBXN2A or control depletion as indicated. (E) Quantification of (D). Shown are means ± SD; n = 3. (F) Loss of SEP domain adapters causes a shift in the PP1 interaction landscape. PP1 was isolated from p47 KO cells after depletion of p37 and UBXN2A or from control-depleted parental cells. Associated proteins were analyzed by quantitative mass spectrometry and results compared in a volcano plot. The black line indicates the threshold for significant differences between treatment conditions (false discovery rate [FDR] < 0.05; s0 = 0.1). Established direct PP1-interacting proteins (Heroes et al., 2013) are marked in black circles, of which those discussed in the text are labeled (closed circles). (G) Indicated proteins from (F) were validated by western blot. (H) Requirement of SEP domain adapters for cell viability and proliferation. Cell populations were treated as indicated and subjected to the 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay at indicated time points. Shown are means ± SD of one represen- tative experiment with technical triplicates. (I) Loss of adapters induces apoptosis. Lysates of indicated cell populations were subjected to western blot analysis to monitor poly ADP-ribose poly- merase 1 (PARP-1) and caspase-3 cleavage. See also Figure S3 and Table S1.
Vector Pgex 6p1, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+6p+1/PGEX-6P-1+Vector/10__1074_slash_jbc__c600051200-19-22-24
Average 96 stars, based on 1 article reviews
vector pgex 6p1 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
lt1  (Addgene inc)
94
Addgene inc lt1
Figure 3. The SEP Domain Adapters <t>p37,</t> p47, and UBXN2A Assist p97 in SDS22-PP1-I3 Disassembly (A) Domain structure of human p97 adapters that share a SEP domain of unknown function. The UBX domain and the SHP box mediate interaction with p97. Only p47 contains a ubiquitin-binding UBA domain. (B) Strep-Tactin pull-downs of indicated strep-hemagglutinin (HA)-tagged (SH) SEP domain adapters and western blot with indicated antibodies. Asterisk indicates an unspecific band detected by the SDS22 antibody. (C) p37, p47, and UBXN2A function partially redundantly as p97 adapters for SDS22-PP1-I3. p47 knockout (KO) or parental cells were treated with indicated siRNAs. p97 was immunoprecipitated and indicated associated proteins detected by western blot. Npl4 was probed as alternative p97 adapter control. (D) Partially redundant roles in PP1 complex disassembly. Autoradiography of pulse-chase experiments in p47 KO or parental HeLa cells combined with siRNA- mediated knockdown of p37 and UBXN2A or control depletion as indicated. (E) Quantification of (D). Shown are means ± SD; n = 3. (F) Loss of SEP domain adapters causes a shift in the PP1 interaction landscape. PP1 was isolated from p47 KO cells after depletion of p37 and UBXN2A or from control-depleted parental cells. Associated proteins were analyzed by quantitative mass spectrometry and results compared in a volcano plot. The black line indicates the threshold for significant differences between treatment conditions (false discovery rate [FDR] < 0.05; s0 = 0.1). Established direct PP1-interacting proteins (Heroes et al., 2013) are marked in black circles, of which those discussed in the text are labeled (closed circles). (G) Indicated proteins from (F) were validated by western blot. (H) Requirement of SEP domain adapters for cell viability and proliferation. Cell populations were treated as indicated and subjected to the 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay at indicated time points. Shown are means ± SD of one represen- tative experiment with technical triplicates. (I) Loss of adapters induces apoptosis. Lysates of indicated cell populations were subjected to western blot analysis to monitor poly ADP-ribose poly- merase 1 (PARP-1) and caspase-3 cleavage. See also Figure S3 and Table S1.
Lt1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+6p+1/pGEX-6P-1-GST-CD(Cbx7)+(Plasmid+%2382525)/bio_rxiv__2023__10__25__564061-253-9-23
Average 94 stars, based on 1 article reviews
lt1 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
vector pgex 6p 1  (Addgene inc)
92
Addgene inc vector pgex 6p 1
Figure 3. The SEP Domain Adapters <t>p37,</t> p47, and UBXN2A Assist p97 in SDS22-PP1-I3 Disassembly (A) Domain structure of human p97 adapters that share a SEP domain of unknown function. The UBX domain and the SHP box mediate interaction with p97. Only p47 contains a ubiquitin-binding UBA domain. (B) Strep-Tactin pull-downs of indicated strep-hemagglutinin (HA)-tagged (SH) SEP domain adapters and western blot with indicated antibodies. Asterisk indicates an unspecific band detected by the SDS22 antibody. (C) p37, p47, and UBXN2A function partially redundantly as p97 adapters for SDS22-PP1-I3. p47 knockout (KO) or parental cells were treated with indicated siRNAs. p97 was immunoprecipitated and indicated associated proteins detected by western blot. Npl4 was probed as alternative p97 adapter control. (D) Partially redundant roles in PP1 complex disassembly. Autoradiography of pulse-chase experiments in p47 KO or parental HeLa cells combined with siRNA- mediated knockdown of p37 and UBXN2A or control depletion as indicated. (E) Quantification of (D). Shown are means ± SD; n = 3. (F) Loss of SEP domain adapters causes a shift in the PP1 interaction landscape. PP1 was isolated from p47 KO cells after depletion of p37 and UBXN2A or from control-depleted parental cells. Associated proteins were analyzed by quantitative mass spectrometry and results compared in a volcano plot. The black line indicates the threshold for significant differences between treatment conditions (false discovery rate [FDR] < 0.05; s0 = 0.1). Established direct PP1-interacting proteins (Heroes et al., 2013) are marked in black circles, of which those discussed in the text are labeled (closed circles). (G) Indicated proteins from (F) were validated by western blot. (H) Requirement of SEP domain adapters for cell viability and proliferation. Cell populations were treated as indicated and subjected to the 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay at indicated time points. Shown are means ± SD of one represen- tative experiment with technical triplicates. (I) Loss of adapters induces apoptosis. Lysates of indicated cell populations were subjected to western blot analysis to monitor poly ADP-ribose poly- merase 1 (PARP-1) and caspase-3 cleavage. See also Figure S3 and Table S1.
Vector Pgex 6p 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+6p+1/pGEX-6P-1+p37+(Plasmid+%23113500)/pmc09316690-131-17-19
Average 92 stars, based on 1 article reviews
vector pgex 6p 1 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
pgex6p1 cdk2  (Addgene inc)
92
Addgene inc pgex6p1 cdk2
Figure 3. The SEP Domain Adapters <t>p37,</t> p47, and UBXN2A Assist p97 in SDS22-PP1-I3 Disassembly (A) Domain structure of human p97 adapters that share a SEP domain of unknown function. The UBX domain and the SHP box mediate interaction with p97. Only p47 contains a ubiquitin-binding UBA domain. (B) Strep-Tactin pull-downs of indicated strep-hemagglutinin (HA)-tagged (SH) SEP domain adapters and western blot with indicated antibodies. Asterisk indicates an unspecific band detected by the SDS22 antibody. (C) p37, p47, and UBXN2A function partially redundantly as p97 adapters for SDS22-PP1-I3. p47 knockout (KO) or parental cells were treated with indicated siRNAs. p97 was immunoprecipitated and indicated associated proteins detected by western blot. Npl4 was probed as alternative p97 adapter control. (D) Partially redundant roles in PP1 complex disassembly. Autoradiography of pulse-chase experiments in p47 KO or parental HeLa cells combined with siRNA- mediated knockdown of p37 and UBXN2A or control depletion as indicated. (E) Quantification of (D). Shown are means ± SD; n = 3. (F) Loss of SEP domain adapters causes a shift in the PP1 interaction landscape. PP1 was isolated from p47 KO cells after depletion of p37 and UBXN2A or from control-depleted parental cells. Associated proteins were analyzed by quantitative mass spectrometry and results compared in a volcano plot. The black line indicates the threshold for significant differences between treatment conditions (false discovery rate [FDR] < 0.05; s0 = 0.1). Established direct PP1-interacting proteins (Heroes et al., 2013) are marked in black circles, of which those discussed in the text are labeled (closed circles). (G) Indicated proteins from (F) were validated by western blot. (H) Requirement of SEP domain adapters for cell viability and proliferation. Cell populations were treated as indicated and subjected to the 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay at indicated time points. Shown are means ± SD of one represen- tative experiment with technical triplicates. (I) Loss of adapters induces apoptosis. Lysates of indicated cell populations were subjected to western blot analysis to monitor poly ADP-ribose poly- merase 1 (PARP-1) and caspase-3 cleavage. See also Figure S3 and Table S1.
Pgex6p1 Cdk2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+6p+1/pGEX+6P1+CDK2+(552)+(Plasmid+%2361845)/pm39733900-51-13-14
Average 92 stars, based on 1 article reviews
pgex6p1 cdk2 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
m korte  (Addgene inc)
91
Addgene inc m korte
Figure 3. The SEP Domain Adapters <t>p37,</t> p47, and UBXN2A Assist p97 in SDS22-PP1-I3 Disassembly (A) Domain structure of human p97 adapters that share a SEP domain of unknown function. The UBX domain and the SHP box mediate interaction with p97. Only p47 contains a ubiquitin-binding UBA domain. (B) Strep-Tactin pull-downs of indicated strep-hemagglutinin (HA)-tagged (SH) SEP domain adapters and western blot with indicated antibodies. Asterisk indicates an unspecific band detected by the SDS22 antibody. (C) p37, p47, and UBXN2A function partially redundantly as p97 adapters for SDS22-PP1-I3. p47 knockout (KO) or parental cells were treated with indicated siRNAs. p97 was immunoprecipitated and indicated associated proteins detected by western blot. Npl4 was probed as alternative p97 adapter control. (D) Partially redundant roles in PP1 complex disassembly. Autoradiography of pulse-chase experiments in p47 KO or parental HeLa cells combined with siRNA- mediated knockdown of p37 and UBXN2A or control depletion as indicated. (E) Quantification of (D). Shown are means ± SD; n = 3. (F) Loss of SEP domain adapters causes a shift in the PP1 interaction landscape. PP1 was isolated from p47 KO cells after depletion of p37 and UBXN2A or from control-depleted parental cells. Associated proteins were analyzed by quantitative mass spectrometry and results compared in a volcano plot. The black line indicates the threshold for significant differences between treatment conditions (false discovery rate [FDR] < 0.05; s0 = 0.1). Established direct PP1-interacting proteins (Heroes et al., 2013) are marked in black circles, of which those discussed in the text are labeled (closed circles). (G) Indicated proteins from (F) were validated by western blot. (H) Requirement of SEP domain adapters for cell viability and proliferation. Cell populations were treated as indicated and subjected to the 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay at indicated time points. Shown are means ± SD of one represen- tative experiment with technical triplicates. (I) Loss of adapters induces apoptosis. Lysates of indicated cell populations were subjected to western blot analysis to monitor poly ADP-ribose poly- merase 1 (PARP-1) and caspase-3 cleavage. See also Figure S3 and Table S1.
M Korte, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+6p+1/pGEX-6P-1+Stu2+1-590+(Plasmid+%2338314)/pm38493476-240-279-288
Average 91 stars, based on 1 article reviews
m korte - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier
pgex 6p 1 ints3 fl  (Addgene inc)
92
Addgene inc pgex 6p 1 ints3 fl
Figure 3. The SEP Domain Adapters <t>p37,</t> p47, and UBXN2A Assist p97 in SDS22-PP1-I3 Disassembly (A) Domain structure of human p97 adapters that share a SEP domain of unknown function. The UBX domain and the SHP box mediate interaction with p97. Only p47 contains a ubiquitin-binding UBA domain. (B) Strep-Tactin pull-downs of indicated strep-hemagglutinin (HA)-tagged (SH) SEP domain adapters and western blot with indicated antibodies. Asterisk indicates an unspecific band detected by the SDS22 antibody. (C) p37, p47, and UBXN2A function partially redundantly as p97 adapters for SDS22-PP1-I3. p47 knockout (KO) or parental cells were treated with indicated siRNAs. p97 was immunoprecipitated and indicated associated proteins detected by western blot. Npl4 was probed as alternative p97 adapter control. (D) Partially redundant roles in PP1 complex disassembly. Autoradiography of pulse-chase experiments in p47 KO or parental HeLa cells combined with siRNA- mediated knockdown of p37 and UBXN2A or control depletion as indicated. (E) Quantification of (D). Shown are means ± SD; n = 3. (F) Loss of SEP domain adapters causes a shift in the PP1 interaction landscape. PP1 was isolated from p47 KO cells after depletion of p37 and UBXN2A or from control-depleted parental cells. Associated proteins were analyzed by quantitative mass spectrometry and results compared in a volcano plot. The black line indicates the threshold for significant differences between treatment conditions (false discovery rate [FDR] < 0.05; s0 = 0.1). Established direct PP1-interacting proteins (Heroes et al., 2013) are marked in black circles, of which those discussed in the text are labeled (closed circles). (G) Indicated proteins from (F) were validated by western blot. (H) Requirement of SEP domain adapters for cell viability and proliferation. Cell populations were treated as indicated and subjected to the 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay at indicated time points. Shown are means ± SD of one represen- tative experiment with technical triplicates. (I) Loss of adapters induces apoptosis. Lysates of indicated cell populations were subjected to western blot analysis to monitor poly ADP-ribose poly- merase 1 (PARP-1) and caspase-3 cleavage. See also Figure S3 and Table S1.
Pgex 6p 1 Ints3 Fl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+6p+1/pGEX-6P-1-INTS3-FL+(Plasmid+%23128415)/pmc11403420-438-6-12
Average 92 stars, based on 1 article reviews
pgex 6p 1 ints3 fl - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc  (Addgene inc)
93
Addgene inc ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc
Figure 3. The SEP Domain Adapters <t>p37,</t> p47, and UBXN2A Assist p97 in SDS22-PP1-I3 Disassembly (A) Domain structure of human p97 adapters that share a SEP domain of unknown function. The UBX domain and the SHP box mediate interaction with p97. Only p47 contains a ubiquitin-binding UBA domain. (B) Strep-Tactin pull-downs of indicated strep-hemagglutinin (HA)-tagged (SH) SEP domain adapters and western blot with indicated antibodies. Asterisk indicates an unspecific band detected by the SDS22 antibody. (C) p37, p47, and UBXN2A function partially redundantly as p97 adapters for SDS22-PP1-I3. p47 knockout (KO) or parental cells were treated with indicated siRNAs. p97 was immunoprecipitated and indicated associated proteins detected by western blot. Npl4 was probed as alternative p97 adapter control. (D) Partially redundant roles in PP1 complex disassembly. Autoradiography of pulse-chase experiments in p47 KO or parental HeLa cells combined with siRNA- mediated knockdown of p37 and UBXN2A or control depletion as indicated. (E) Quantification of (D). Shown are means ± SD; n = 3. (F) Loss of SEP domain adapters causes a shift in the PP1 interaction landscape. PP1 was isolated from p47 KO cells after depletion of p37 and UBXN2A or from control-depleted parental cells. Associated proteins were analyzed by quantitative mass spectrometry and results compared in a volcano plot. The black line indicates the threshold for significant differences between treatment conditions (false discovery rate [FDR] < 0.05; s0 = 0.1). Established direct PP1-interacting proteins (Heroes et al., 2013) are marked in black circles, of which those discussed in the text are labeled (closed circles). (G) Indicated proteins from (F) were validated by western blot. (H) Requirement of SEP domain adapters for cell viability and proliferation. Cell populations were treated as indicated and subjected to the 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay at indicated time points. Shown are means ± SD of one represen- tative experiment with technical triplicates. (I) Loss of adapters induces apoptosis. Lysates of indicated cell populations were subjected to western blot analysis to monitor poly ADP-ribose poly- merase 1 (PARP-1) and caspase-3 cleavage. See also Figure S3 and Table S1.
Ttgaacctgatctccatcca N A N A Recombinant Dna Pca24n Nbrp Rrid Ncbitaxon 146876 Pcp20 Cgsc Cgsc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex+6p+1/pGEX-6P-1-HsTNRC6Biso1_1219-1723-del1395-1534_L+(Plasmid+%23146876)/pm40934913-322-181-195
Average 93 stars, based on 1 article reviews
ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


Loss of Cited2 Impairs Expression of Genes Specifying Cardiac Mesoderm (A) Percentage of colonies with beating foci derived from C2 fl/fl and C2 Δ/Δ [LA11] ESC at D8 and D10 of differentiation. (B) Percentage of colonies with beating foci counted at 8 and 10 days after the initiation of differentiation in cell cultures derived from C2 fl/fl [Cre] ESC treated with ethanol or 4HT at D0 of differentiation, and with 4HT at D0 of differentiation and supplemented with recombinant 8R-CITED2 protein at D2 of differentiation (4HT + 8R-CITED2). (C) Expression of Activin A and Nodal determined by qPCR at D2 and D3 of differentiation in cultures derived from C2 fl/fl [Cre] ESC treated with 4HT or ethanol at D0 for 48 hr. (D) Expression of mesoderm markers ( Brachyury and Mesp1 ) at D2, D3, D5, and D12 of differentiation in cells generated from C2 fl/fl [Cre] ESC treated as described in ( B). (E) Expression of Isl1 , Gata4 , Nkx2.5 , and Tbx5 in cell cultures as described in (D). The inserts for Isl1 and Tbx5 detail the expression of these genes at D5 and D3, respectively. (F) Relative expression of Brachyury , Mesp1 , Isl1 , Gata4 , Nkx2.5 , and Tbx5 determined by qPCR at D5 of differentiation in cultures derived from untreated C2 fl/fl and C2 Δ/Δ [LA11] ESC, and C2 Δ/Δ [LA11] ESC supplemented with the recombinant 8R-CITED2 protein (C2 Δ/Δ [LA11] + 8R-CITED2) at D2 of differentiation for 48 hr. Gene expression in C2 fl/fl ESC was set to 1. (G) Enrichment of Isl1 genomic regions in extracts of E14/T ESC-derived cells at D5 by ChIP assays with anti-CITED2 or control (immunoglobulin G) polyclonal antibodies. Results are presented as the mean ± SEM of three independent biological experiments.

Journal: Stem Cell Reports

Article Title: CITED2 Cooperates with ISL1 and Promotes Cardiac Differentiation of Mouse Embryonic Stem Cells

doi: 10.1016/j.stemcr.2016.10.002

Figure Lengend Snippet: Loss of Cited2 Impairs Expression of Genes Specifying Cardiac Mesoderm (A) Percentage of colonies with beating foci derived from C2 fl/fl and C2 Δ/Δ [LA11] ESC at D8 and D10 of differentiation. (B) Percentage of colonies with beating foci counted at 8 and 10 days after the initiation of differentiation in cell cultures derived from C2 fl/fl [Cre] ESC treated with ethanol or 4HT at D0 of differentiation, and with 4HT at D0 of differentiation and supplemented with recombinant 8R-CITED2 protein at D2 of differentiation (4HT + 8R-CITED2). (C) Expression of Activin A and Nodal determined by qPCR at D2 and D3 of differentiation in cultures derived from C2 fl/fl [Cre] ESC treated with 4HT or ethanol at D0 for 48 hr. (D) Expression of mesoderm markers ( Brachyury and Mesp1 ) at D2, D3, D5, and D12 of differentiation in cells generated from C2 fl/fl [Cre] ESC treated as described in ( B). (E) Expression of Isl1 , Gata4 , Nkx2.5 , and Tbx5 in cell cultures as described in (D). The inserts for Isl1 and Tbx5 detail the expression of these genes at D5 and D3, respectively. (F) Relative expression of Brachyury , Mesp1 , Isl1 , Gata4 , Nkx2.5 , and Tbx5 determined by qPCR at D5 of differentiation in cultures derived from untreated C2 fl/fl and C2 Δ/Δ [LA11] ESC, and C2 Δ/Δ [LA11] ESC supplemented with the recombinant 8R-CITED2 protein (C2 Δ/Δ [LA11] + 8R-CITED2) at D2 of differentiation for 48 hr. Gene expression in C2 fl/fl ESC was set to 1. (G) Enrichment of Isl1 genomic regions in extracts of E14/T ESC-derived cells at D5 by ChIP assays with anti-CITED2 or control (immunoglobulin G) polyclonal antibodies. Results are presented as the mean ± SEM of three independent biological experiments.

Article Snippet: Full-length human CITED2 cDNA and an oligonucleotide encoding eight arginines (8R) were cloned into the pGEX6P1 vector (GE Healthcare Life Sciences) to express a chimeric protein consisting of the GST in fusion with the 8R domain and CITED2 (termed GST-8R-CITED2, ).

Techniques: Expressing, Derivative Assay, Recombinant, Generated, Gene Expression, Control

FIGURE 1 | Generation of a p300 construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 1 | Generation of a p300 construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Construct, Expressing, Purification, Activity Assay, Molecular Weight, Solubility

FIGURE 2 | Pre-acetylation of p300 does not meaningfully alter acetyltransferase activity. (A) Overlaid 13C, 1H-HSQC NMR spectra showing re- action products after 1 h treatment of histone H4 (1-25)W with native p300 (teal) or p300 prescribed to a 2-h incubation with acetyl-CoA (purple). (B) overlaid 1D projections of the 13C, 1H-HSQC experiments demonstrate nearly equivalent peak heights for the acetyl-CoA (2.25 ppm) and acetyllysine (1.87 ppm 1H) products. (C) MALDI-MS spectra showing the distributions of reaction products.

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 2 | Pre-acetylation of p300 does not meaningfully alter acetyltransferase activity. (A) Overlaid 13C, 1H-HSQC NMR spectra showing re- action products after 1 h treatment of histone H4 (1-25)W with native p300 (teal) or p300 prescribed to a 2-h incubation with acetyl-CoA (purple). (B) overlaid 1D projections of the 13C, 1H-HSQC experiments demonstrate nearly equivalent peak heights for the acetyl-CoA (2.25 ppm) and acetyllysine (1.87 ppm 1H) products. (C) MALDI-MS spectra showing the distributions of reaction products.

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Activity Assay, Incubation

FIGURE 3 | Comparison of p300 and p300Δ acetyltransferase activity towards the histone H4 tail. (A) Circular dichroism spectra for p300 (teal) and p300Δ (pink) used to estimate secondary structure content with BestSel. (B) MALDI-MS time courses comparing relative acetyltransferase ef- ficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (C) Mono-exponential fit of acetyltransferase reaction curves from a 1H-13C, HSQC based NMR time course for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail. Progress curves show the increase in intensity for the acetyllysine resonance centered at 1.86 ppm 1H, 22.1 ppm 13C over time, each data point represents the maximum acetyllysine peak intensity from a 3 min and 36 s experiment. Progress curves were fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (D) Progress curves for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail fit with a bi-exponential kinetic model to estimate relative turnover rates (k1 and k2) and relative contributions to the maximum intensity (A1 and A2). R2 values are included in C and D to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 3 | Comparison of p300 and p300Δ acetyltransferase activity towards the histone H4 tail. (A) Circular dichroism spectra for p300 (teal) and p300Δ (pink) used to estimate secondary structure content with BestSel. (B) MALDI-MS time courses comparing relative acetyltransferase ef- ficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (C) Mono-exponential fit of acetyltransferase reaction curves from a 1H-13C, HSQC based NMR time course for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail. Progress curves show the increase in intensity for the acetyllysine resonance centered at 1.86 ppm 1H, 22.1 ppm 13C over time, each data point represents the maximum acetyllysine peak intensity from a 3 min and 36 s experiment. Progress curves were fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (D) Progress curves for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail fit with a bi-exponential kinetic model to estimate relative turnover rates (k1 and k2) and relative contributions to the maximum intensity (A1 and A2). R2 values are included in C and D to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Comparison, Activity Assay, Circular Dichroism

FIGURE 4 | Validation of 12C propionyl-CoA synthesis and con- trol reactions to enable 13C propionylation resonance assignments. (A) Proton 1D NMR spectra showing the reaction product of the propionyl- CoA (green) synthesis reaction from propionic anhydride precursor (gray). The peaks at 1.06 and 2.56 ppm, respectively, were assigned to the methyl and methylene protons of the CoA conjugated propionyl moiety based on comparison to reference proton 1D spectra provided by CoALA Biosciences (SKU PC01). (B) Overlaid 13C, 1H-HSQC NMR spectra of the propionyltransferase reaction mixture (without enzyme) before adding 13C propionyl-CoA (gray) and after adding 13C propionyl- CoA (green). (C) Overlaid 13C, 1H-HSQC NMR spectra for p300 cata- lyzed propionylation of the histone H4 tail (green) overlaid with the ap- propriate no enzyme control (gray).

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 4 | Validation of 12C propionyl-CoA synthesis and con- trol reactions to enable 13C propionylation resonance assignments. (A) Proton 1D NMR spectra showing the reaction product of the propionyl- CoA (green) synthesis reaction from propionic anhydride precursor (gray). The peaks at 1.06 and 2.56 ppm, respectively, were assigned to the methyl and methylene protons of the CoA conjugated propionyl moiety based on comparison to reference proton 1D spectra provided by CoALA Biosciences (SKU PC01). (B) Overlaid 13C, 1H-HSQC NMR spectra of the propionyltransferase reaction mixture (without enzyme) before adding 13C propionyl-CoA (gray) and after adding 13C propionyl- CoA (green). (C) Overlaid 13C, 1H-HSQC NMR spectra for p300 cata- lyzed propionylation of the histone H4 tail (green) overlaid with the ap- propriate no enzyme control (gray).

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Biomarker Discovery, Comparison, Control

FIGURE 5 | Comparison of p300 and p300Δ propionyltransferase activity towards the histone H4 tail. (A) MALDI-MS time course com- paring relative propionyltransferase efficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (B) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (C) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a lagged mono-exponential kinetic model to estimate relative turnover rate (k1), amplitude (A), lag time (t0), and slope around t0 (α). R2 values are included in B and C to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 5 | Comparison of p300 and p300Δ propionyltransferase activity towards the histone H4 tail. (A) MALDI-MS time course com- paring relative propionyltransferase efficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (B) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (C) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a lagged mono-exponential kinetic model to estimate relative turnover rate (k1), amplitude (A), lag time (t0), and slope around t0 (α). R2 values are included in B and C to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Comparison, Activity Assay

Figure 3. The SEP Domain Adapters p37, p47, and UBXN2A Assist p97 in SDS22-PP1-I3 Disassembly (A) Domain structure of human p97 adapters that share a SEP domain of unknown function. The UBX domain and the SHP box mediate interaction with p97. Only p47 contains a ubiquitin-binding UBA domain. (B) Strep-Tactin pull-downs of indicated strep-hemagglutinin (HA)-tagged (SH) SEP domain adapters and western blot with indicated antibodies. Asterisk indicates an unspecific band detected by the SDS22 antibody. (C) p37, p47, and UBXN2A function partially redundantly as p97 adapters for SDS22-PP1-I3. p47 knockout (KO) or parental cells were treated with indicated siRNAs. p97 was immunoprecipitated and indicated associated proteins detected by western blot. Npl4 was probed as alternative p97 adapter control. (D) Partially redundant roles in PP1 complex disassembly. Autoradiography of pulse-chase experiments in p47 KO or parental HeLa cells combined with siRNA- mediated knockdown of p37 and UBXN2A or control depletion as indicated. (E) Quantification of (D). Shown are means ± SD; n = 3. (F) Loss of SEP domain adapters causes a shift in the PP1 interaction landscape. PP1 was isolated from p47 KO cells after depletion of p37 and UBXN2A or from control-depleted parental cells. Associated proteins were analyzed by quantitative mass spectrometry and results compared in a volcano plot. The black line indicates the threshold for significant differences between treatment conditions (false discovery rate [FDR] < 0.05; s0 = 0.1). Established direct PP1-interacting proteins (Heroes et al., 2013) are marked in black circles, of which those discussed in the text are labeled (closed circles). (G) Indicated proteins from (F) were validated by western blot. (H) Requirement of SEP domain adapters for cell viability and proliferation. Cell populations were treated as indicated and subjected to the 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay at indicated time points. Shown are means ± SD of one represen- tative experiment with technical triplicates. (I) Loss of adapters induces apoptosis. Lysates of indicated cell populations were subjected to western blot analysis to monitor poly ADP-ribose poly- merase 1 (PARP-1) and caspase-3 cleavage. See also Figure S3 and Table S1.

Journal: Molecular cell

Article Title: Ubiquitin-Independent Disassembly by a p97 AAA-ATPase Complex Drives PP1 Holoenzyme Formation.

doi: 10.1016/j.molcel.2018.09.020

Figure Lengend Snippet: Figure 3. The SEP Domain Adapters p37, p47, and UBXN2A Assist p97 in SDS22-PP1-I3 Disassembly (A) Domain structure of human p97 adapters that share a SEP domain of unknown function. The UBX domain and the SHP box mediate interaction with p97. Only p47 contains a ubiquitin-binding UBA domain. (B) Strep-Tactin pull-downs of indicated strep-hemagglutinin (HA)-tagged (SH) SEP domain adapters and western blot with indicated antibodies. Asterisk indicates an unspecific band detected by the SDS22 antibody. (C) p37, p47, and UBXN2A function partially redundantly as p97 adapters for SDS22-PP1-I3. p47 knockout (KO) or parental cells were treated with indicated siRNAs. p97 was immunoprecipitated and indicated associated proteins detected by western blot. Npl4 was probed as alternative p97 adapter control. (D) Partially redundant roles in PP1 complex disassembly. Autoradiography of pulse-chase experiments in p47 KO or parental HeLa cells combined with siRNA- mediated knockdown of p37 and UBXN2A or control depletion as indicated. (E) Quantification of (D). Shown are means ± SD; n = 3. (F) Loss of SEP domain adapters causes a shift in the PP1 interaction landscape. PP1 was isolated from p47 KO cells after depletion of p37 and UBXN2A or from control-depleted parental cells. Associated proteins were analyzed by quantitative mass spectrometry and results compared in a volcano plot. The black line indicates the threshold for significant differences between treatment conditions (false discovery rate [FDR] < 0.05; s0 = 0.1). Established direct PP1-interacting proteins (Heroes et al., 2013) are marked in black circles, of which those discussed in the text are labeled (closed circles). (G) Indicated proteins from (F) were validated by western blot. (H) Requirement of SEP domain adapters for cell viability and proliferation. Cell populations were treated as indicated and subjected to the 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay at indicated time points. Shown are means ± SD of one represen- tative experiment with technical triplicates. (I) Loss of adapters induces apoptosis. Lysates of indicated cell populations were subjected to western blot analysis to monitor poly ADP-ribose poly- merase 1 (PARP-1) and caspase-3 cleavage. See also Figure S3 and Table S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sip47 s1: AGCCAGCUCUUCCAUCUUATT Microsynth N/A sip37 s1: GUGCCGUAAUAUAGAGGAATT Microsynth N/A sip37 s2: CAGUUUAGAUGAUGGAGAATT Microsynth N/A siUBXN2A s1: AGAAGAGGUGGACGUUAAATT Microsynth N/A siUBXN2A s2: GAAAUAUGUUUGUCUACGATT Microsynth N/A siPP1 Santa Cruz sc-43545 Recombinant DNA p47 CRISPR/Cas9 KO plasmid Santa Cruz sc-402328 p47 HDR plasmid Santa Cruz sc-402328-HDR pEVOL-pBpF plasmid Addgene #31190 pcDNA5FRT/TO-p37-Strep-HA H€ulsmann et al., 2018; Addgene #113485 pcDNA5FRT/TO-p47-Strep-HA H€ulsmann et al., 2018; Addgene #113475 pcDNA5FRT/TO-UBXN2A-Strep-HA H€ulsmann et al., 2018; Addgene #113480 pcDNA5FRT/TO-UBXN11-Strep-HA H€ulsmann et al., 2018; Addgene #113493 pcDNA5FRT/TO-Ufd1-Strep-HA H€ulsmann et al., 2018; Addgene #113474 pcDNA5/FRT/TO/GFP-SH R. Aebersold; H€ulsmann et al., 2018 N/A pGEX-6P-1 p37 This study; Addgene #113500 pGEX-6P-1 p37deltaSEP This study; Addgene #113501 pGEX-6P-1 p37deltaN This study; Addgene #113502 pGEX-6P-1 p37 SHPmut This study; Addgene #113503 pGEX-6P-1 p37 deltaUBX This study; Addgene #113504 pGEX-4T-1 UBXN2A This study; Addgene #113505 pcDNA5FRT/TO PP1gamma-2*Strep This study; Addgene #113506 pET15b His-p97 This study; Addgene #113507 pET15b p97-Strep-His E314Amb This study; Addgene #113508 pET15b p97-His D592Amb This study; Addgene #113509 pFL His-p97 This study; Addgene #113510 pFL His-SDS22 / PP1gamma This study; Addgene #113511 pFL His-I3 This study; Addgene #113513 pFL I3 This study; Addgene #113514 pFL His-I3 V41A / W43A This study; Addgene #113515 pFL His-mEos3.2-I3 This study; Addgene #113516 Software and Algorithms FlowJo v10.5.0 FlowJo, LLC https://www.flowjo.com/ OriginPro 2016G OriginLab https://www.originlab.com/ MaxQuant v1.5.3.30 and the MaxLFQ algorithm Cox et al., 2014 http://www.biochem.mpg.de/ 5111795/maxquant Perseus v1.5.5.3 Tyanova et al., 2016 http://www.biochem.mpg.de/ 5111810/perseus SigmaPlot v12.5 Systat Software http://www.systat.de/ SigmaPlot_Produktseite.html PyMol Schrödinger, LLC https://www.pymol.org/2/ Cell Profiler Kamentsky et al., 2011 http://www.cellprofiler.org/

Techniques: Ubiquitin Proteomics, Binding Assay, Western Blot, Knock-Out, Immunoprecipitation, Control, Autoradiography, Pulse Chase, Knockdown, Isolation, Mass Spectrometry, Labeling, MTS Assay

Figure 4. The p37 Adapter Recruits p97 to the SDS22-PP1-I3 Complex by Direct Binding of the SEP Domain to I3 (A) Cartoon structure of p37 mutant proteins used here. The asterisk indicates SHP box mutations that interfere with p97 binding. (B) Direct binding of p97-p37 to SDS22-PP1-I3 requires the p37 SEP domain and interaction between p97 and p37. The SDS22-PP1-I3 complex generated in insect cells was incubated with p97 and p37 or indicated p37 mutants. PP1 was isolated and associated proteins analyzed by western blot. (C) Homology modeling of p37 based on the p47 SEP domain structure (PDB: 1SS6). Positions of genetically encoded crosslink amino acids are indicated. (D) I3, but not SDS22 or PP1, forms crosslinks with residue 182 in the SEP domain of p37. SDS22-PP1-I3 was incubated with p97 and the p37-L182pBPA variant, UV irradiated as indicated, and processed for western blotting with indicated antibodies. (E) Experiments as in (D) with p37 crosslink variants L182pBPA or F89pBPA and indicated components. (F) p97-p37 binding to the PP1 complex depends on I3. SDS22-PP1 and I3 were generated separately. Binding assays with SDS22-PP1 in the presence or absence of I3 or I3mut with mutations in the RVXF motif that abrogate PP1 binding are shown. (G) Model for recruitment of p97 to the PP1 complex. S, SEP domain; U, UBX domain. See also Figure S4.

Journal: Molecular cell

Article Title: Ubiquitin-Independent Disassembly by a p97 AAA-ATPase Complex Drives PP1 Holoenzyme Formation.

doi: 10.1016/j.molcel.2018.09.020

Figure Lengend Snippet: Figure 4. The p37 Adapter Recruits p97 to the SDS22-PP1-I3 Complex by Direct Binding of the SEP Domain to I3 (A) Cartoon structure of p37 mutant proteins used here. The asterisk indicates SHP box mutations that interfere with p97 binding. (B) Direct binding of p97-p37 to SDS22-PP1-I3 requires the p37 SEP domain and interaction between p97 and p37. The SDS22-PP1-I3 complex generated in insect cells was incubated with p97 and p37 or indicated p37 mutants. PP1 was isolated and associated proteins analyzed by western blot. (C) Homology modeling of p37 based on the p47 SEP domain structure (PDB: 1SS6). Positions of genetically encoded crosslink amino acids are indicated. (D) I3, but not SDS22 or PP1, forms crosslinks with residue 182 in the SEP domain of p37. SDS22-PP1-I3 was incubated with p97 and the p37-L182pBPA variant, UV irradiated as indicated, and processed for western blotting with indicated antibodies. (E) Experiments as in (D) with p37 crosslink variants L182pBPA or F89pBPA and indicated components. (F) p97-p37 binding to the PP1 complex depends on I3. SDS22-PP1 and I3 were generated separately. Binding assays with SDS22-PP1 in the presence or absence of I3 or I3mut with mutations in the RVXF motif that abrogate PP1 binding are shown. (G) Model for recruitment of p97 to the PP1 complex. S, SEP domain; U, UBX domain. See also Figure S4.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sip47 s1: AGCCAGCUCUUCCAUCUUATT Microsynth N/A sip37 s1: GUGCCGUAAUAUAGAGGAATT Microsynth N/A sip37 s2: CAGUUUAGAUGAUGGAGAATT Microsynth N/A siUBXN2A s1: AGAAGAGGUGGACGUUAAATT Microsynth N/A siUBXN2A s2: GAAAUAUGUUUGUCUACGATT Microsynth N/A siPP1 Santa Cruz sc-43545 Recombinant DNA p47 CRISPR/Cas9 KO plasmid Santa Cruz sc-402328 p47 HDR plasmid Santa Cruz sc-402328-HDR pEVOL-pBpF plasmid Addgene #31190 pcDNA5FRT/TO-p37-Strep-HA H€ulsmann et al., 2018; Addgene #113485 pcDNA5FRT/TO-p47-Strep-HA H€ulsmann et al., 2018; Addgene #113475 pcDNA5FRT/TO-UBXN2A-Strep-HA H€ulsmann et al., 2018; Addgene #113480 pcDNA5FRT/TO-UBXN11-Strep-HA H€ulsmann et al., 2018; Addgene #113493 pcDNA5FRT/TO-Ufd1-Strep-HA H€ulsmann et al., 2018; Addgene #113474 pcDNA5/FRT/TO/GFP-SH R. Aebersold; H€ulsmann et al., 2018 N/A pGEX-6P-1 p37 This study; Addgene #113500 pGEX-6P-1 p37deltaSEP This study; Addgene #113501 pGEX-6P-1 p37deltaN This study; Addgene #113502 pGEX-6P-1 p37 SHPmut This study; Addgene #113503 pGEX-6P-1 p37 deltaUBX This study; Addgene #113504 pGEX-4T-1 UBXN2A This study; Addgene #113505 pcDNA5FRT/TO PP1gamma-2*Strep This study; Addgene #113506 pET15b His-p97 This study; Addgene #113507 pET15b p97-Strep-His E314Amb This study; Addgene #113508 pET15b p97-His D592Amb This study; Addgene #113509 pFL His-p97 This study; Addgene #113510 pFL His-SDS22 / PP1gamma This study; Addgene #113511 pFL His-I3 This study; Addgene #113513 pFL I3 This study; Addgene #113514 pFL His-I3 V41A / W43A This study; Addgene #113515 pFL His-mEos3.2-I3 This study; Addgene #113516 Software and Algorithms FlowJo v10.5.0 FlowJo, LLC https://www.flowjo.com/ OriginPro 2016G OriginLab https://www.originlab.com/ MaxQuant v1.5.3.30 and the MaxLFQ algorithm Cox et al., 2014 http://www.biochem.mpg.de/ 5111795/maxquant Perseus v1.5.5.3 Tyanova et al., 2016 http://www.biochem.mpg.de/ 5111810/perseus SigmaPlot v12.5 Systat Software http://www.systat.de/ SigmaPlot_Produktseite.html PyMol Schrödinger, LLC https://www.pymol.org/2/ Cell Profiler Kamentsky et al., 2011 http://www.cellprofiler.org/

Techniques: Binding Assay, Mutagenesis, Generated, Incubation, Isolation, Western Blot, Residue, Variant Assay, Irradiation

Figure 5. Reconstitution of SDS22-PP1-I3 Disassembly by p97-p37 with Pure Components in the Absence of Ubiquitination (A) Rapid PP1 subunit exchange at sub-stoichiometric concentrations of p97. Purified SDS22-PP1-I3 was incubated with NIPP1 and p97-p37 at the indicated molar ratios in the presence of ATP or ATPgS. Disassembly and exchange to NIPP1 was followed over time by co-immunoprecipitation of PP1g. (B) Reactions were carried out as in (A) in the presence or absence of ATP, ATPgS, or p37 as indicated and separated by size-exclusion chromatography. Note co-migration of the PP1 complex with the p97 hexamer in the presence of ATPgS dependent on p37 and disassembly of the PP1 complex to monomers with ATP. (C) p37 function depends on the SEP domain. Disassembly reactions as in (A) were carried out with p97 (3 nM) and p37 wild-type (wt) or p37 DSEP (50 nM). (D) I3 binding to PP1 is required for SDS22-PP1 disassembly. Reactions in the presence or absence of I3 or the PP1 binding-deficient I3mut are shown. See also Figure S5.

Journal: Molecular cell

Article Title: Ubiquitin-Independent Disassembly by a p97 AAA-ATPase Complex Drives PP1 Holoenzyme Formation.

doi: 10.1016/j.molcel.2018.09.020

Figure Lengend Snippet: Figure 5. Reconstitution of SDS22-PP1-I3 Disassembly by p97-p37 with Pure Components in the Absence of Ubiquitination (A) Rapid PP1 subunit exchange at sub-stoichiometric concentrations of p97. Purified SDS22-PP1-I3 was incubated with NIPP1 and p97-p37 at the indicated molar ratios in the presence of ATP or ATPgS. Disassembly and exchange to NIPP1 was followed over time by co-immunoprecipitation of PP1g. (B) Reactions were carried out as in (A) in the presence or absence of ATP, ATPgS, or p37 as indicated and separated by size-exclusion chromatography. Note co-migration of the PP1 complex with the p97 hexamer in the presence of ATPgS dependent on p37 and disassembly of the PP1 complex to monomers with ATP. (C) p37 function depends on the SEP domain. Disassembly reactions as in (A) were carried out with p97 (3 nM) and p37 wild-type (wt) or p37 DSEP (50 nM). (D) I3 binding to PP1 is required for SDS22-PP1 disassembly. Reactions in the presence or absence of I3 or the PP1 binding-deficient I3mut are shown. See also Figure S5.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sip47 s1: AGCCAGCUCUUCCAUCUUATT Microsynth N/A sip37 s1: GUGCCGUAAUAUAGAGGAATT Microsynth N/A sip37 s2: CAGUUUAGAUGAUGGAGAATT Microsynth N/A siUBXN2A s1: AGAAGAGGUGGACGUUAAATT Microsynth N/A siUBXN2A s2: GAAAUAUGUUUGUCUACGATT Microsynth N/A siPP1 Santa Cruz sc-43545 Recombinant DNA p47 CRISPR/Cas9 KO plasmid Santa Cruz sc-402328 p47 HDR plasmid Santa Cruz sc-402328-HDR pEVOL-pBpF plasmid Addgene #31190 pcDNA5FRT/TO-p37-Strep-HA H€ulsmann et al., 2018; Addgene #113485 pcDNA5FRT/TO-p47-Strep-HA H€ulsmann et al., 2018; Addgene #113475 pcDNA5FRT/TO-UBXN2A-Strep-HA H€ulsmann et al., 2018; Addgene #113480 pcDNA5FRT/TO-UBXN11-Strep-HA H€ulsmann et al., 2018; Addgene #113493 pcDNA5FRT/TO-Ufd1-Strep-HA H€ulsmann et al., 2018; Addgene #113474 pcDNA5/FRT/TO/GFP-SH R. Aebersold; H€ulsmann et al., 2018 N/A pGEX-6P-1 p37 This study; Addgene #113500 pGEX-6P-1 p37deltaSEP This study; Addgene #113501 pGEX-6P-1 p37deltaN This study; Addgene #113502 pGEX-6P-1 p37 SHPmut This study; Addgene #113503 pGEX-6P-1 p37 deltaUBX This study; Addgene #113504 pGEX-4T-1 UBXN2A This study; Addgene #113505 pcDNA5FRT/TO PP1gamma-2*Strep This study; Addgene #113506 pET15b His-p97 This study; Addgene #113507 pET15b p97-Strep-His E314Amb This study; Addgene #113508 pET15b p97-His D592Amb This study; Addgene #113509 pFL His-p97 This study; Addgene #113510 pFL His-SDS22 / PP1gamma This study; Addgene #113511 pFL His-I3 This study; Addgene #113513 pFL I3 This study; Addgene #113514 pFL His-I3 V41A / W43A This study; Addgene #113515 pFL His-mEos3.2-I3 This study; Addgene #113516 Software and Algorithms FlowJo v10.5.0 FlowJo, LLC https://www.flowjo.com/ OriginPro 2016G OriginLab https://www.originlab.com/ MaxQuant v1.5.3.30 and the MaxLFQ algorithm Cox et al., 2014 http://www.biochem.mpg.de/ 5111795/maxquant Perseus v1.5.5.3 Tyanova et al., 2016 http://www.biochem.mpg.de/ 5111810/perseus SigmaPlot v12.5 Systat Software http://www.systat.de/ SigmaPlot_Produktseite.html PyMol Schrödinger, LLC https://www.pymol.org/2/ Cell Profiler Kamentsky et al., 2011 http://www.cellprofiler.org/

Techniques: Ubiquitin Proteomics, Incubation, Immunoprecipitation, Size-exclusion Chromatography, Migration, Binding Assay

Figure 6. PP1 Complex Disassembly Involves ATPase-Driven Pulling of I3 into the Central Channel of p97 and Concomitant Unfolding (A) Positions of genetically encoded crosslink amino acids at the pore loops of D1 (E314pBPA) or D2 (D592pBPA) within the channel of the p97 hexamer. (B) p97 variants harboring the indicated crosslink amino acids were UV activated during disassembly reactions and crosslink products analyzed by western blot with indicated antibodies (WB). Note that the signal at the top of the gel likely corresponds to multiple copies of p97 crosslinked to I3 and to each other. (C) Crosslinks were carried out in the presence of ATP or ATPgS with or without p37 as indicated. Note that I3 crosslinks to D1 and D2 depended on p37 and that D2 crosslinks were suppressed by ATPgS. (D) Unfolding of a reporter domain on I3. A complex of SDS22, PP1, and I3 fused to Eos was incubated with different concentrations of p97, p37, or Ufd1-Npl4 and ATP or ATPgS as indicated. Eos fluorescence was monitored by spectrometry. A peptide backbone break in Eos was induced beforehand to prevent refolding. (E) Unfolding depends on binding of p37 to I3 and to p97. Experiments as in (D) with indicated p37 variants are shown. See also Figure S6.

Journal: Molecular cell

Article Title: Ubiquitin-Independent Disassembly by a p97 AAA-ATPase Complex Drives PP1 Holoenzyme Formation.

doi: 10.1016/j.molcel.2018.09.020

Figure Lengend Snippet: Figure 6. PP1 Complex Disassembly Involves ATPase-Driven Pulling of I3 into the Central Channel of p97 and Concomitant Unfolding (A) Positions of genetically encoded crosslink amino acids at the pore loops of D1 (E314pBPA) or D2 (D592pBPA) within the channel of the p97 hexamer. (B) p97 variants harboring the indicated crosslink amino acids were UV activated during disassembly reactions and crosslink products analyzed by western blot with indicated antibodies (WB). Note that the signal at the top of the gel likely corresponds to multiple copies of p97 crosslinked to I3 and to each other. (C) Crosslinks were carried out in the presence of ATP or ATPgS with or without p37 as indicated. Note that I3 crosslinks to D1 and D2 depended on p37 and that D2 crosslinks were suppressed by ATPgS. (D) Unfolding of a reporter domain on I3. A complex of SDS22, PP1, and I3 fused to Eos was incubated with different concentrations of p97, p37, or Ufd1-Npl4 and ATP or ATPgS as indicated. Eos fluorescence was monitored by spectrometry. A peptide backbone break in Eos was induced beforehand to prevent refolding. (E) Unfolding depends on binding of p37 to I3 and to p97. Experiments as in (D) with indicated p37 variants are shown. See also Figure S6.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER sip47 s1: AGCCAGCUCUUCCAUCUUATT Microsynth N/A sip37 s1: GUGCCGUAAUAUAGAGGAATT Microsynth N/A sip37 s2: CAGUUUAGAUGAUGGAGAATT Microsynth N/A siUBXN2A s1: AGAAGAGGUGGACGUUAAATT Microsynth N/A siUBXN2A s2: GAAAUAUGUUUGUCUACGATT Microsynth N/A siPP1 Santa Cruz sc-43545 Recombinant DNA p47 CRISPR/Cas9 KO plasmid Santa Cruz sc-402328 p47 HDR plasmid Santa Cruz sc-402328-HDR pEVOL-pBpF plasmid Addgene #31190 pcDNA5FRT/TO-p37-Strep-HA H€ulsmann et al., 2018; Addgene #113485 pcDNA5FRT/TO-p47-Strep-HA H€ulsmann et al., 2018; Addgene #113475 pcDNA5FRT/TO-UBXN2A-Strep-HA H€ulsmann et al., 2018; Addgene #113480 pcDNA5FRT/TO-UBXN11-Strep-HA H€ulsmann et al., 2018; Addgene #113493 pcDNA5FRT/TO-Ufd1-Strep-HA H€ulsmann et al., 2018; Addgene #113474 pcDNA5/FRT/TO/GFP-SH R. Aebersold; H€ulsmann et al., 2018 N/A pGEX-6P-1 p37 This study; Addgene #113500 pGEX-6P-1 p37deltaSEP This study; Addgene #113501 pGEX-6P-1 p37deltaN This study; Addgene #113502 pGEX-6P-1 p37 SHPmut This study; Addgene #113503 pGEX-6P-1 p37 deltaUBX This study; Addgene #113504 pGEX-4T-1 UBXN2A This study; Addgene #113505 pcDNA5FRT/TO PP1gamma-2*Strep This study; Addgene #113506 pET15b His-p97 This study; Addgene #113507 pET15b p97-Strep-His E314Amb This study; Addgene #113508 pET15b p97-His D592Amb This study; Addgene #113509 pFL His-p97 This study; Addgene #113510 pFL His-SDS22 / PP1gamma This study; Addgene #113511 pFL His-I3 This study; Addgene #113513 pFL I3 This study; Addgene #113514 pFL His-I3 V41A / W43A This study; Addgene #113515 pFL His-mEos3.2-I3 This study; Addgene #113516 Software and Algorithms FlowJo v10.5.0 FlowJo, LLC https://www.flowjo.com/ OriginPro 2016G OriginLab https://www.originlab.com/ MaxQuant v1.5.3.30 and the MaxLFQ algorithm Cox et al., 2014 http://www.biochem.mpg.de/ 5111795/maxquant Perseus v1.5.5.3 Tyanova et al., 2016 http://www.biochem.mpg.de/ 5111810/perseus SigmaPlot v12.5 Systat Software http://www.systat.de/ SigmaPlot_Produktseite.html PyMol Schrödinger, LLC https://www.pymol.org/2/ Cell Profiler Kamentsky et al., 2011 http://www.cellprofiler.org/

Techniques: Western Blot, Incubation, Binding Assay