|
Addgene inc
pgex sesn2 Pgex Sesn2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex sesn2/product/Addgene inc Average 90 stars, based on 1 article reviews
pgex sesn2 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Danaher Inc
pgex 6p 1 vector Pgex 6p 1 Vector, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex 6p 1 vector/product/Danaher Inc Average 96 stars, based on 1 article reviews
pgex 6p 1 vector - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Addgene inc
ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc Ttgaacctgatctccatcca N A N A Recombinant Dna Pca24n Nbrp Rrid Ncbitaxon 146876 Pcp20 Cgsc Cgsc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc/product/Addgene inc Average 93 stars, based on 1 article reviews
ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
human p300 ![]() Human P300, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human p300/product/Addgene inc Average 93 stars, based on 1 article reviews
human p300 - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
m korte ![]() M Korte, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m korte/product/Addgene inc Average 91 stars, based on 1 article reviews
m korte - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
|
Addgene inc
pgex 6p 1 ![]() Pgex 6p 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex 6p 1/product/Addgene inc Average 92 stars, based on 1 article reviews
pgex 6p 1 - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pgex 6p 1 gst plasmid ![]() Pgex 6p 1 Gst Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex 6p 1 gst plasmid/product/Addgene inc Average 93 stars, based on 1 article reviews
pgex 6p 1 gst plasmid - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
alcohol inducible promoters pyfac ch2 ubi y pyrg ![]() Alcohol Inducible Promoters Pyfac Ch2 Ubi Y Pyrg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/alcohol inducible promoters pyfac ch2 ubi y pyrg/product/Addgene inc Average 92 stars, based on 1 article reviews
alcohol inducible promoters pyfac ch2 ubi y pyrg - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pgex 6p ![]() Pgex 6p, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex 6p/product/Addgene inc Average 94 stars, based on 1 article reviews
pgex 6p - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
Addgene inc
construct psfarc c001 ![]() Construct Psfarc C001, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/construct psfarc c001/product/Addgene inc Average 92 stars, based on 1 article reviews
construct psfarc c001 - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
|
Addgene inc
3clpro ![]() 3clpro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/3clpro/product/Addgene inc Average 93 stars, based on 1 article reviews
3clpro - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
human gst cdk2 ![]() Human Gst Cdk2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human gst cdk2/product/Addgene inc Average 92 stars, based on 1 article reviews
human gst cdk2 - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Proteins
Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.
doi: 10.1002/prot.26848
Figure Lengend Snippet: FIGURE 1 | Generation of a p300 construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (
Techniques: Construct, Expressing, Purification, Activity Assay, Molecular Weight, Solubility
Journal: Proteins
Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.
doi: 10.1002/prot.26848
Figure Lengend Snippet: FIGURE 2 | Pre-acetylation of p300 does not meaningfully alter acetyltransferase activity. (A) Overlaid 13C, 1H-HSQC NMR spectra showing re- action products after 1 h treatment of histone H4 (1-25)W with native p300 (teal) or p300 prescribed to a 2-h incubation with acetyl-CoA (purple). (B) overlaid 1D projections of the 13C, 1H-HSQC experiments demonstrate nearly equivalent peak heights for the acetyl-CoA (2.25 ppm) and acetyllysine (1.87 ppm 1H) products. (C) MALDI-MS spectra showing the distributions of reaction products.
Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (
Techniques: Activity Assay, Incubation
Journal: Proteins
Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.
doi: 10.1002/prot.26848
Figure Lengend Snippet: FIGURE 3 | Comparison of p300 and p300Δ acetyltransferase activity towards the histone H4 tail. (A) Circular dichroism spectra for p300 (teal) and p300Δ (pink) used to estimate secondary structure content with BestSel. (B) MALDI-MS time courses comparing relative acetyltransferase ef- ficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (C) Mono-exponential fit of acetyltransferase reaction curves from a 1H-13C, HSQC based NMR time course for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail. Progress curves show the increase in intensity for the acetyllysine resonance centered at 1.86 ppm 1H, 22.1 ppm 13C over time, each data point represents the maximum acetyllysine peak intensity from a 3 min and 36 s experiment. Progress curves were fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (D) Progress curves for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail fit with a bi-exponential kinetic model to estimate relative turnover rates (k1 and k2) and relative contributions to the maximum intensity (A1 and A2). R2 values are included in C and D to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.
Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (
Techniques: Comparison, Activity Assay, Circular Dichroism
Journal: Proteins
Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.
doi: 10.1002/prot.26848
Figure Lengend Snippet: FIGURE 4 | Validation of 12C propionyl-CoA synthesis and con- trol reactions to enable 13C propionylation resonance assignments. (A) Proton 1D NMR spectra showing the reaction product of the propionyl- CoA (green) synthesis reaction from propionic anhydride precursor (gray). The peaks at 1.06 and 2.56 ppm, respectively, were assigned to the methyl and methylene protons of the CoA conjugated propionyl moiety based on comparison to reference proton 1D spectra provided by CoALA Biosciences (SKU PC01). (B) Overlaid 13C, 1H-HSQC NMR spectra of the propionyltransferase reaction mixture (without enzyme) before adding 13C propionyl-CoA (gray) and after adding 13C propionyl- CoA (green). (C) Overlaid 13C, 1H-HSQC NMR spectra for p300 cata- lyzed propionylation of the histone H4 tail (green) overlaid with the ap- propriate no enzyme control (gray).
Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (
Techniques: Biomarker Discovery, Comparison, Control
Journal: Proteins
Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.
doi: 10.1002/prot.26848
Figure Lengend Snippet: FIGURE 5 | Comparison of p300 and p300Δ propionyltransferase activity towards the histone H4 tail. (A) MALDI-MS time course com- paring relative propionyltransferase efficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (B) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (C) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a lagged mono-exponential kinetic model to estimate relative turnover rate (k1), amplitude (A), lag time (t0), and slope around t0 (α). R2 values are included in B and C to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.
Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (
Techniques: Comparison, Activity Assay
Journal: Cell reports
Article Title: SARS-CoV-2 3CL pro (main protease) regulates caspase activation of gasdermin-D/E pores leading to secretion and extracellular activity of 3CL pro .
doi: 10.1016/j.celrep.2024.115080
Figure Lengend Snippet: Figure 1. SARS-CoV-2 3CLpro is released from infected cells by cell lysis and secreted by an unconventional protein-secretion mechanism (A) Immunoblots of 3CLpro precipitated by 33% trichloroacetic acid (TCA) from the conditioned media or in lysates from mock-infected or A549-ACE2 cells 48 hpi with SARS-CoV-2 (MOI 4, n = 5, N = 2). stds, 3CLpro standards. Densitometry of 3CLpro relative to 10 ng 3CLpro standard. (B) 3CLpro, b-tubulin, and GAPDH immunoblots and densitometry of 3CLpro in 33% TCA-precipitated conditioned media or cell lysate from mock-infected or SARS-CoV-2-infected A549-ACE2 cells 48 hpi with MOI 0.1 or 1.0. Dotted line, intracellular 3CLpro/tubulin ratio in MOI 1.0 cell lysate (n = 3/group). (C) Immunoblots and densitometry of 3CLpro in 33% TCA-precipitated conditioned media compared to matched lysates from SARS-CoV-2-infected Vero76 cells 48 hpi (MOI 1) or mock-infected cells (n = 3/group). 3CLpro ppt, 10 ng of 3CLpro precipitated from cell-naive media as a control; std, 10 ng of 3CLpro standard. (D) Immunoblots of 3CLpro in conditioned media concentrated by ultrafiltration and cell lysates from HEK293 cells transfected with 3CLpro expression plasmid for 48 h (n = 8, N = 2). (E) LDH activity in conditioned medium collected from 3CLpro transfected HEK293 cells (48 h) compared with the maximum amount of LDH released from lysed HEK293 cells (n = 6, N = 2). Absorbance was measured at 490 nm with 680 nm correction. (F) Immunoblots and densitometry of 3CLpro in concentrated conditioned medium and cell lysates from HEK293 cells transiently transfected with plasmids encoding 3CLpro or catalytic inactive 3CLpro Cys145Ala for 48 h (n = 5, N = 2). (G) Immunoblots and densitometry of 3CLpro or IFN-l1 after 24 h culture ± Golgi inhibitor 2 mM monensin (n = 6, N = 2). (H) 3CLpro, GSDMD, and b-actin loading control immunoblots and GSDMD densitometry of lysates from mock-infected or SARS-CoV-2-infected A549-ACE2 cells 48 hpi, MOI 0.1 or 1.0 (n = 3/group). (I) Schematic of candidate mechanisms of 3CLpro release from SARS-CoV-2-infected cells. Antibodies: anti-3CLpro (1:1,000, in-house), anti-b-tubulin (1:2,000, clone: BT7R), anti-b-actin (1:2,000, ab8226), anti-GAPDH (1:2,000, clone: GA1R), anti- GSDMD N-terminal antibody (1:500, clone: W18029B), and anti-FLAG M2 (IFN-l1 in G) (1:1,000, F3165). Data are shown as mean ± SD; statistical analysis of two groups was performed by two-tailed unpaired t test, three or more groups by one-way ANOVA with Tukey’s post hoc test, with a significance threshold of p < 0.05.
Article Snippet: SARS-CoV-2 3CLpro expression and purification Recombinant proteins were expressed from DNA expression vectors for active
Techniques: Infection, Lysis, Western Blot, Control, Transfection, Expressing, Plasmid Preparation, Activity Assay, Two Tailed Test
Journal: Cell reports
Article Title: SARS-CoV-2 3CL pro (main protease) regulates caspase activation of gasdermin-D/E pores leading to secretion and extracellular activity of 3CL pro .
doi: 10.1016/j.celrep.2024.115080
Figure Lengend Snippet: Figure 2. SARS-CoV-2 3CLpro cleaves GSDMD at LQ29Y30SS to block GSDMD pore formation, whereas caspase cleavage generates func- tional GSDMD pores that directly secrete 3CLpro and nucleocapsid protein (A) Schematic of 3CLpro cleavage sites (non-prime side [P] in blue, prime side [P0] in red) and the caspase cleavage site (violet) in human GSDMD. Y, scissile bond.
Article Snippet: SARS-CoV-2 3CLpro expression and purification Recombinant proteins were expressed from DNA expression vectors for active
Techniques: Blocking Assay
Journal: Cell reports
Article Title: SARS-CoV-2 3CL pro (main protease) regulates caspase activation of gasdermin-D/E pores leading to secretion and extracellular activity of 3CL pro .
doi: 10.1016/j.celrep.2024.115080
Figure Lengend Snippet: Figure 3. SARS-CoV-2 3CLpro is secreted through caspase-activated GSDMD and GSDME pores and retains activity in serum to dampen platelet activation (A) Recombinant 3CLpro (2 mM) was incubated with or without recombinant GSDME (3 mg) for 2 h at 37C and resolved on 4%–12% reducing SDS-PAGE stained with Coomassie (N = 2). 3CLpro with C-terminal 33FLAG-Myc-63His tag was used. (legend continued on next page)
Article Snippet: SARS-CoV-2 3CLpro expression and purification Recombinant proteins were expressed from DNA expression vectors for active
Techniques: Activity Assay, Activation Assay, Recombinant, Incubation, SDS Page, Staining
Journal: Cell reports
Article Title: SARS-CoV-2 3CL pro (main protease) regulates caspase activation of gasdermin-D/E pores leading to secretion and extracellular activity of 3CL pro .
doi: 10.1016/j.celrep.2024.115080
Figure Lengend Snippet: Figure 4. SARS-CoV-2 3CLpro cleaves and inactivates IFN-l1 (A) Coomassie-stained 4%–12% SDS-PAGE gel of recombinant human IFN-l1 (2 mg) incubated alone, with active 3CLpro, or with inactive Cys145Ala mutant (2.5 mM) for 20 h showing an 15-kDa cleavage fragment (band 5) (N = 12). Bands 1–4 were identified by Edman sequencing to be the mature N terminus of intact IFN-l1, thus indicating multiple post-translational modified proteoforms of IFN-l1. The 3CLpro-cleavage fragment also commenced with the mature N-terminal sequence (band 5), indicating C-terminal truncation. (B) Amino-terminal oriented mass spectrometry (ATOMS) identification of 3CLpro cleavage sites in IFN-l1 by MS/MS peak analysis of isotopically heavy [C13H3]2- dimethylated(*) neo-N-terminal peptides 130*ACIQPQPTAGPRPR and 155*EAPKKESAGCLEASVTFNLFR, which were identified only in 3CLpro-treated samples. (C) Time course of 3CLpro cleavage of peptides spanning the P6–P60 ILSQLQ129Y130ACIQPQ(YR) sequence of IFN-l1 (top) and a non-cleavable P1-Q129A peptide (bottom) incubated over 4 h at 37C (n = 2, N = 2). (D) Schematic of the human IFN-l1 sequence highlighting the mature N terminus (black), the non-prime P5–P1 sequence (blue), and the prime P10–P50 sequence (red) of both cleavage sites. (E) IFN-l1 ribbon diagram structural model color coded according to B-factor analysis (PDB: 3O6G).68 Helices A to E are labeled as are the first and last resolved N-terminal (S41) and C-terminal (L189) residues, respectively, and both cleavage sites at the P1-Q and P10-A/E.
Article Snippet: SARS-CoV-2 3CLpro expression and purification Recombinant proteins were expressed from DNA expression vectors for active
Techniques: Staining, SDS Page, Recombinant, Incubation, Mutagenesis, Sequencing, Mass Spectrometry, Tandem Mass Spectroscopy, Labeling